View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_low_83 (Length: 240)
Name: NF11453_low_83
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_low_83 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 52484068 - 52483851
Alignment:
| Q |
1 |
ctcaccctcaactcgttcgaaaaccttctttgttagagagagttatgtccttcaatctcaacaaacacgaaccacaatatccacagagtcagacacatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52484068 |
ctcaccctcaactcgttcgaaaaccttctttgttagagagagttatgtccttcaatctcaacaaacacgaaccacaatatccacaga------cacatta |
52483975 |
T |
 |
| Q |
101 |
cgttcaacccgagtctgagtctgactcaactaagcctcaactcgttagaaaaccgtctcttttacaacgagtcatgtccttcaatctcaacaaaaacgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52483974 |
cgttcaacccgagtctgagtctgactcaactaagcctcaactcgttagaaaaccgtctcttttacaacgagtcatgtccttcaatctcaacaaaaacgta |
52483875 |
T |
 |
| Q |
201 |
ccagcacaaccagaagctgaaaac |
224 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
52483874 |
ccagcacaaccggaagctgaaaac |
52483851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 149 - 215
Target Start/End: Complemental strand, 52464762 - 52464696
Alignment:
| Q |
149 |
aaaaccgtctcttttacaacgagtcatgtccttcaatctcaacaaaaacgaaccagcacaaccagaa |
215 |
Q |
| |
|
|||||| || || ||||| |||||| |||| ||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
52464762 |
aaaaccttcactgttacagcgagtcttgtctttcaatctcaacaaacacgaaccagcacaaacagaa |
52464696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University