View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_low_86 (Length: 238)
Name: NF11453_low_86
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_low_86 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 79 - 218
Target Start/End: Original strand, 49986145 - 49986284
Alignment:
| Q |
79 |
tctccagtccacgcattcatgcaataaacacattagtggcatttggatagggattggacggtgcaaaaagaaatcatattttgattttattactcttaaa |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49986145 |
tctccagtccacgcattcatgcaataaacacattagtggcatttggatagggattggacggtgcaaaaagaaatcatattttgattttattactcttaaa |
49986244 |
T |
 |
| Q |
179 |
tgccaagcttgagatctgcaccatgccaccatccaatctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49986245 |
tgccaagcttgagatctgcaccatgccaccatccaatctc |
49986284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 49986016 - 49986096
Alignment:
| Q |
1 |
ataaaacatgctgccttgtattattttgtctcctgtcaaatgctagtgttacatcttcactttccttggccctcactttct |
81 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49986016 |
ataaaacatgctgccttgtagcattttgtctgctgtcaaatgctagtgttacatcttcactttccttggccctcactttct |
49986096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University