View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_low_88 (Length: 238)
Name: NF11453_low_88
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_low_88 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 46 - 224
Target Start/End: Complemental strand, 45362752 - 45362574
Alignment:
| Q |
46 |
gcaaacaactattagtaaaaaataattaaaagaaacctttttctggagagacattcaatttaacatcagaaacaagggaatcacttgaactccnnnnnnn |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362752 |
gcaaacaactattagtaaaaaataattaaaagaaacctttttctggagagacattcaatttaacatcagaaacaagggaatcacttgaactccaaaaaaa |
45362653 |
T |
|
| Q |
146 |
catatcaagatccttcgttttcttagcagcagcaacgttttttggagagaacatttcggggtttggcgcagggtaattc |
224 |
Q |
| |
|
||||| |||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362652 |
catatgaagatcctccgttttcttagcagcaacaacgttttttggagagaacatttcggggtttggcgcagggtaattc |
45362574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University