View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_low_93 (Length: 227)
Name: NF11453_low_93
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_low_93 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 34768133 - 34768340
Alignment:
| Q |
1 |
gatgaaacccaatccaaaccaactttaatcgtatttagttattgactacaggaatttatttaaaataatttatttatttgtaattattctcatatttaac |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34768133 |
gatgaaacccagtccaaaccaactttaatcgtatttagttattgactacaggaatttatttaaaataatttatttatttgttattattctcatatttaac |
34768232 |
T |
 |
| Q |
101 |
ctagcccagttttatgacatgtttctttatttctaaatttgtcttctttatataacttttttacgcaatatcagagttttactatatttattgactcagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34768233 |
ctagcccagttttatgacatgtttctttatttctaaatttgtcttctttatacaacttttttacgcaatatcaaagttttactatatttattgactcagt |
34768332 |
T |
 |
| Q |
201 |
gaaaattt |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
34768333 |
gaaaattt |
34768340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University