View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_low_95 (Length: 222)
Name: NF11453_low_95
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_low_95 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 3 - 222
Target Start/End: Original strand, 33119935 - 33120154
Alignment:
| Q |
3 |
gtgtgaatgaaggggactcattataggattggtttcgatgtcgttggtcatttgaatgaaggtcattacaaagtgccgtgccataaacgttaagttctgt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
33119935 |
gtgtgaatgaaggggactcattataggattggtttcgatgtcgttggtcatttgaatgaaggtcattacaaagtgccgtgccatcaacatcaagttctgt |
33120034 |
T |
 |
| Q |
103 |
ttgttatgtgtcgttgagacgttacagagtgaacgatatttggttagccgttggaagcatttgaggagcaggacagacccaaggtctattgacttggtct |
202 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33120035 |
ttgttatgtgtcgttgagacattacagagtgaacgatatttggctagccgttggaagcatttgaggagcaggacagacccaaggtctattgacttggtct |
33120134 |
T |
 |
| Q |
203 |
agtgaccgtcttcggctcaa |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33120135 |
agtgaccgtcttcggctcaa |
33120154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University