View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_low_99 (Length: 213)
Name: NF11453_low_99
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_low_99 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 55341772 - 55341954
Alignment:
| Q |
15 |
gagatggatttccaagcaagacttgccatgcttggcgcagcnnnnnnnnnnnnntaagctggccttagcactacaggaaactgattactacttgttagac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55341772 |
gagatggatttccaagcaagacttgccatgcttggtgcagcaaaaaacaaaaaataagctggccttagcactacaggaaactgattactacttgttagac |
55341871 |
T |
|
| Q |
115 |
gctgatacagcgtcacaaatagaatcaaataatgtaccattcctaatgaatacattgaaattgcaatctcgttccaaccaatt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55341872 |
gctgatacagcgtcacaaatagaatcaaataatgtaccattcctaatgaatacattgaaattgcaatctcgttccaaccaatt |
55341954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University