View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11455_high_20 (Length: 311)
Name: NF11455_high_20
Description: NF11455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11455_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 219 - 291
Target Start/End: Original strand, 47527011 - 47527083
Alignment:
| Q |
219 |
aaattgtgtttttgtgcagtttgatataagatttggagtttttgatatggattctcgttcaccacctcctgat |
291 |
Q |
| |
|
||||||||||||||||||| ||| |||| || ||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47527011 |
aaattgtgtttttgtgcagattggtatatgaattgaagtttttgatatggattctcgttcactacctcctgat |
47527083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 179
Target Start/End: Original strand, 47526905 - 47526948
Alignment:
| Q |
136 |
tgcatttgttgaggaagtgggttttatttttgttggggtatgtt |
179 |
Q |
| |
|
||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
47526905 |
tgcatttgttgtggaattgagttttatttttgttggggtatgtt |
47526948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 291
Target Start/End: Original strand, 47521786 - 47521834
Alignment:
| Q |
243 |
tataagatttggagtttttgatatggattctcgttcaccacctcctgat |
291 |
Q |
| |
|
|||| |||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
47521786 |
tatatgatttggattttttgatatggcttctcgttcagtacctcctgat |
47521834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 218 - 288
Target Start/End: Complemental strand, 44872653 - 44872583
Alignment:
| Q |
218 |
gaaattgtgtttttgtgcagtttgatataagatttggagtttttgatatggattctcgttcaccacctcct |
288 |
Q |
| |
|
||||| |||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44872653 |
gaaatagtgtttttgtgcagattggtatacagtttggagtttttgatatggattctcgttcaccacctcct |
44872583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 179
Target Start/End: Complemental strand, 44873067 - 44873013
Alignment:
| Q |
125 |
atggcataacttgcatttgttgaggaagtgggttttatttttgttggggtatgtt |
179 |
Q |
| |
|
||||| ||| |||||||||| | |||||||||||||||||||||| |||||||| |
|
|
| T |
44873067 |
atggcttaatttgcatttgtggtcgaagtgggttttatttttgttgtggtatgtt |
44873013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University