View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11455_high_31 (Length: 247)
Name: NF11455_high_31
Description: NF11455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11455_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 8442949 - 8442713
Alignment:
| Q |
1 |
ttaagacgtatgtatttacaaattgtatatatttttcataaataaaataaaattaacatttttacatttgcaaggaactaaatgatattgcaatgtctac |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8442949 |
ttaagacgtatgtatttacaaattatatatatttttcataaataaaataaaattaacagttttacatttgcaaggaatcaaatgatattgcaatgtctac |
8442850 |
T |
|
| Q |
101 |
acacatctgttgcaccgataatcctaatcgaaaatgtgtctcagtgtccaacatatgtcatgtctaaagatgacaccgacacttatgattatattaagtt |
200 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||| | |||||||||||||||||||||| |||||||||||||||| | ||||||||||||||| |
|
|
| T |
8442849 |
acacctctgttgcaccgataattctaatcgaaaatgtgttttagtgtccaacatatgtcatgtccgaagatgacaccgacacctttgattatattaagtt |
8442750 |
T |
|
| Q |
201 |
atgttattttttaaaaaatttattcattattgtgtct |
237 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
8442749 |
atgttatttttttaaaattttattcattattgtgtct |
8442713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 17257988 - 17258030
Alignment:
| Q |
170 |
atgacaccgacacttatgattatattaagttatgttatttttt |
212 |
Q |
| |
|
|||||||||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
17257988 |
atgacaccgacacttatgattacattgaattatgttatttttt |
17258030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 14077439 - 14077475
Alignment:
| Q |
176 |
ccgacacttatgattatattaagttatgttatttttt |
212 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
14077439 |
ccgacacttataattatattaaattatgttatttttt |
14077475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 14387467 - 14387503
Alignment:
| Q |
176 |
ccgacacttatgattatattaagttatgttatttttt |
212 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
14387467 |
ccgacacttataattatattaaattatgttatttttt |
14387503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University