View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11455_high_35 (Length: 240)

Name: NF11455_high_35
Description: NF11455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11455_high_35
NF11455_high_35
[»] chr6 (1 HSPs)
chr6 (1-179)||(4616528-4616706)


Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 4616706 - 4616528
Alignment:
1 cttcaaccttgacttcctgaaaataaagtttctcagctttgtaaatagagaaagcaaaatcacccaattcagggagtgttgtgtgcaatgcacagtccca 100  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
4616706 cttcaaccttgacttcctgaaaataaagcttctcagctttgtaaatagagaaagcaaaatcacccaattcagggagtgttgtgtgcgatgcacagtccca 4616607  T
101 aacttgaacaccctgcgcgatgcgccggtgcttctgtgggatgcacacgaggcgggcctgtcctgtgttttcttcaact 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
4616606 aacttgaacaccctgcgcgatgcgccggtgcttctgtgggatgcacatgaggcgggcctgtcctgtgttttcttcaact 4616528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University