View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11455_low_20 (Length: 311)

Name: NF11455_low_20
Description: NF11455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11455_low_20
NF11455_low_20
[»] chr3 (3 HSPs)
chr3 (219-291)||(47527011-47527083)
chr3 (136-179)||(47526905-47526948)
chr3 (243-291)||(47521786-47521834)
[»] chr7 (2 HSPs)
chr7 (218-288)||(44872583-44872653)
chr7 (125-179)||(44873013-44873067)


Alignment Details
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 219 - 291
Target Start/End: Original strand, 47527011 - 47527083
Alignment:
219 aaattgtgtttttgtgcagtttgatataagatttggagtttttgatatggattctcgttcaccacctcctgat 291  Q
    ||||||||||||||||||| ||| |||| || ||| |||||||||||||||||||||||||| ||||||||||    
47527011 aaattgtgtttttgtgcagattggtatatgaattgaagtttttgatatggattctcgttcactacctcctgat 47527083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 179
Target Start/End: Original strand, 47526905 - 47526948
Alignment:
136 tgcatttgttgaggaagtgggttttatttttgttggggtatgtt 179  Q
    ||||||||||| |||| || ||||||||||||||||||||||||    
47526905 tgcatttgttgtggaattgagttttatttttgttggggtatgtt 47526948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 291
Target Start/End: Original strand, 47521786 - 47521834
Alignment:
243 tataagatttggagtttttgatatggattctcgttcaccacctcctgat 291  Q
    |||| |||||||| |||||||||||| ||||||||||  ||||||||||    
47521786 tatatgatttggattttttgatatggcttctcgttcagtacctcctgat 47521834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 218 - 288
Target Start/End: Complemental strand, 44872653 - 44872583
Alignment:
218 gaaattgtgtttttgtgcagtttgatataagatttggagtttttgatatggattctcgttcaccacctcct 288  Q
    ||||| |||||||||||||| ||| ||||   |||||||||||||||||||||||||||||||||||||||    
44872653 gaaatagtgtttttgtgcagattggtatacagtttggagtttttgatatggattctcgttcaccacctcct 44872583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 179
Target Start/End: Complemental strand, 44873067 - 44873013
Alignment:
125 atggcataacttgcatttgttgaggaagtgggttttatttttgttggggtatgtt 179  Q
    ||||| ||| |||||||||| |  |||||||||||||||||||||| ||||||||    
44873067 atggcttaatttgcatttgtggtcgaagtgggttttatttttgttgtggtatgtt 44873013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University