View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11455_low_32 (Length: 244)
Name: NF11455_low_32
Description: NF11455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11455_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 15 - 226
Target Start/End: Original strand, 8443291 - 8443500
Alignment:
| Q |
15 |
caaaggcatgcccttaggaggaatgttttggagttannnnnnngtcttttctttgtttatcttctacgtaaagttgaataacaaattcaccaattcgtga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8443291 |
caaaggcatgcccttaggaggaatgttttggagtt-tttttttgtcttttctttgtttatcttctacgtaaagttgaataacaaattcaccaattcgtga |
8443389 |
T |
|
| Q |
115 |
cttacacgttggttgatcgcactgtttttgctcaacttacgttttctctcttttttccatagttccttcctcaaaatacttgtcgataaatgattagaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8443390 |
cttacacgttggttgatcgcactgtttttgctcaacttacgttttctctc-tttttccatagttccttcctcaaaatacttgtcgagaaatgattagaaa |
8443488 |
T |
|
| Q |
215 |
gaccgtaatggt |
226 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8443489 |
gaccgtaatggt |
8443500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University