View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11455_low_37 (Length: 232)
Name: NF11455_low_37
Description: NF11455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11455_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 97 - 222
Target Start/End: Original strand, 41620081 - 41620206
Alignment:
| Q |
97 |
taatccatctttttaaaaggttataggaatgccactgacttatattgtttactatgaaagttcacaaatcaaactggttttactacttgtttttataaca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41620081 |
taatccatctttttaaaaggttataggaatgccactgacttatattgtttactatgaaagttcacaaatcaaactggttttactacttgtttttataaca |
41620180 |
T |
|
| Q |
197 |
tgggaatttttgttttctctgcttct |
222 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
41620181 |
tgggaatttttgttttctctgtttct |
41620206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 178
Target Start/End: Complemental strand, 42121427 - 42121391
Alignment:
| Q |
142 |
tgtttactatgaaagttcacaaatcaaactggtttta |
178 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
42121427 |
tgtttactatgaaagttcaccaatcaaactgatttta |
42121391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University