View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11455_low_37 (Length: 232)

Name: NF11455_low_37
Description: NF11455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11455_low_37
NF11455_low_37
[»] chr5 (2 HSPs)
chr5 (97-222)||(41620081-41620206)
chr5 (142-178)||(42121391-42121427)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 97 - 222
Target Start/End: Original strand, 41620081 - 41620206
Alignment:
97 taatccatctttttaaaaggttataggaatgccactgacttatattgtttactatgaaagttcacaaatcaaactggttttactacttgtttttataaca 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41620081 taatccatctttttaaaaggttataggaatgccactgacttatattgtttactatgaaagttcacaaatcaaactggttttactacttgtttttataaca 41620180  T
197 tgggaatttttgttttctctgcttct 222  Q
    ||||||||||||||||||||| ||||    
41620181 tgggaatttttgttttctctgtttct 41620206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 178
Target Start/End: Complemental strand, 42121427 - 42121391
Alignment:
142 tgtttactatgaaagttcacaaatcaaactggtttta 178  Q
    |||||||||||||||||||| |||||||||| |||||    
42121427 tgtttactatgaaagttcaccaatcaaactgatttta 42121391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University