View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11456_low_10 (Length: 239)
Name: NF11456_low_10
Description: NF11456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11456_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 67 - 224
Target Start/End: Complemental strand, 49996044 - 49995887
Alignment:
| Q |
67 |
agttctatttagtttaatgctaaagtgtatttaaggtgtaaagatgagattttattttataagccacttgatattggtgttaacattgtaatattcatat |
166 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49996044 |
agttctatttagtgtaatgctaaagtgtatttaaggtgtaaagatgagattttattttataagccacttgatattggtgttaacattgtaatattcatat |
49995945 |
T |
 |
| Q |
167 |
tttaggtggaaaggatattcaacctcagtagttcctcccaaatagagtacaaggtatt |
224 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49995944 |
tttaggtggaaagggtattcaacctcagtagttcctcccaaatagagtacaaggtatt |
49995887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 49996073 - 49996045
Alignment:
| Q |
1 |
ataataatactacgtctcatatgggatcg |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49996073 |
ataataatactacgtctcatatgggatcg |
49996045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University