View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11456_low_3 (Length: 480)
Name: NF11456_low_3
Description: NF11456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11456_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 125 - 462
Target Start/End: Complemental strand, 11297797 - 11297459
Alignment:
| Q |
125 |
acttagcacttaatatgagaggtgcatgttgtaaatagt-ctatccacaaacatgttctctttttctccaataataacaccctcttccctcccatcttca |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11297797 |
acttagcacttaatatgagaggtgcatgttgtaaatagttctatccacaaacatgttttctttttctccaataataacaccctcttccctcccatcttca |
11297698 |
T |
|
| Q |
224 |
acggtattaacaacttcttacccttactattttccttcaaaaatgtcttcaatcagttctcatactccattgcttttctgattctctaggttctcaagtt |
323 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11297697 |
acggtattaacaacttcttactcttactattttccttcaaaaatgtcttcaatcagttctcatactccattgcttttctgattctctaggttctcaagtt |
11297598 |
T |
|
| Q |
324 |
ggaaactttttcgcttaaaaatggtgggtttgtcagaattggagggattactgctccttcaatgatacctacaagtagaaaattagctagatgttctgtt |
423 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11297597 |
ggaaactttttcgcttaaaaatggtgggtttatcagaattggagggattactgctccttcaatgatacctacaagtagaaaattagctagatgttctgtt |
11297498 |
T |
|
| Q |
424 |
tcagcttctggtgatggcaatgcttctgttcagactgat |
462 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11297497 |
tcagcttctggtgatggcaatgcttctgttcagactgat |
11297459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 31 - 82
Target Start/End: Complemental strand, 11297908 - 11297857
Alignment:
| Q |
31 |
cccctcgatttagaccgtttgatcttctgtgggacaaatttatgagttagac |
82 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
11297908 |
cccctcgatttagaccatttgatcttctgtgagacaaatttatgagttagac |
11297857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University