View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11457_high_21 (Length: 224)

Name: NF11457_high_21
Description: NF11457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11457_high_21
NF11457_high_21
[»] chr8 (1 HSPs)
chr8 (60-207)||(37975533-37975680)


Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 60 - 207
Target Start/End: Original strand, 37975533 - 37975680
Alignment:
60 gtcaactttgtaatgtgcctaataaatcacagaatctaatctaagctataaaccatatcatctcgatcattacattatagattagcttttcctgcatgtt 159  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||    
37975533 gtcaactttgtaatgtgcctaataaatcacagaatctaatctaagccataaaccataccatctcgatcattacattatagattagcttttcctgcatgtt 37975632  T
160 tcttgttgcaataacacgggcacagctttttgcatgtgcataatatct 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
37975633 tcttgttgcaataacacgggcacagctttttgcatgtgcataatatct 37975680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University