View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11457_low_20 (Length: 247)
Name: NF11457_low_20
Description: NF11457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11457_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 49244600 - 49244667
Alignment:
| Q |
19 |
aggaacaaattgaagcaaatgttcactcacctcactaccactgtccctactctccaccccaatgttaa |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49244600 |
aggaacaaattgaagcaaatgttcactcacctcactaccactgtccctactctccaccccaatgttaa |
49244667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 186
Target Start/End: Original strand, 49244738 - 49244775
Alignment:
| Q |
149 |
atcgacccattatagcttgatttgttatctgaaatggg |
186 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49244738 |
atcgacccattatagtttgatttgttatctgaaatggg |
49244775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University