View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11457_low_24 (Length: 224)
Name: NF11457_low_24
Description: NF11457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11457_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 60 - 207
Target Start/End: Original strand, 37975533 - 37975680
Alignment:
| Q |
60 |
gtcaactttgtaatgtgcctaataaatcacagaatctaatctaagctataaaccatatcatctcgatcattacattatagattagcttttcctgcatgtt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37975533 |
gtcaactttgtaatgtgcctaataaatcacagaatctaatctaagccataaaccataccatctcgatcattacattatagattagcttttcctgcatgtt |
37975632 |
T |
 |
| Q |
160 |
tcttgttgcaataacacgggcacagctttttgcatgtgcataatatct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37975633 |
tcttgttgcaataacacgggcacagctttttgcatgtgcataatatct |
37975680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University