View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11457_low_4 (Length: 458)
Name: NF11457_low_4
Description: NF11457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11457_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 19 - 192
Target Start/End: Complemental strand, 36563840 - 36563667
Alignment:
| Q |
19 |
gttcaaggttagttaaatgtgattaatgcgcaaggaaagtttggttggagtttttaatgaccagtttgtatgtggtttttattgtttcttctaggtatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36563840 |
gttcaaggttagttaaatgtgattaatgcgcaaggaaagtttggttggagtttttaatgaccagtttgtatgtggtttttattgtttcttctaggtatga |
36563741 |
T |
 |
| Q |
119 |
ctataaacatttaatttcttgtcaatgtctcatcgcccttcaccattttttaaggtatgaaatgttatgaaata |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36563740 |
ctataaacatttaatttcttgtcaatgtctcatcgcccttcaccattttttaaggtatgaaatgttatgaaata |
36563667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 191 - 310
Target Start/End: Complemental strand, 36563539 - 36563419
Alignment:
| Q |
191 |
tatgatttaatagataagttaaattagttttacatattctccctaccagatggcatacttttacattgaatcttttccctcacatccttaa-caaaaaac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||| || | |
|
|
| T |
36563539 |
tatgatttaatagataagttaaattagttttaaatattctccctaccagatgacatacttttacattgaatcttttctctcacatccttaagcaataagc |
36563440 |
T |
 |
| Q |
290 |
actttaccattagactgaact |
310 |
Q |
| |
|
|||| | ||||||||||||| |
|
|
| T |
36563439 |
acttggctattagactgaact |
36563419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University