View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11458_low_7 (Length: 303)

Name: NF11458_low_7
Description: NF11458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11458_low_7
NF11458_low_7
[»] chr4 (1 HSPs)
chr4 (19-290)||(55015809-55016080)


Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 19 - 290
Target Start/End: Original strand, 55015809 - 55016080
Alignment:
19 gcaagcaggcctaaagactctcccattcgtctcatcttcagcatgggaaagtgtgccatcaactctgccgaatacggcccactctggcgctccctccgcc 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
55015809 gcaagcaggcctaaagactctcccattcgtctcatcttcagcatgggaaagtgtgccatcaactctgctgaatacggcccactctggcgctccctccgcc 55015908  T
119 gcaaccttgtgacggagatgatatcaccacttagagtaaaacagtgcagttggatcagaaaatgggccatggaagctcacatgagaaggatccaaaatga 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55015909 gcaaccttgtgacggagatgatatcaccacttagagtaaaacagtgcagttggatcagaaaatgggccatggaagctcacatgagaaggatccaaaatga 55016008  T
219 agcacatgaaaatggttttgttgaagtgatgagtaattgcagactcaccatttgtagcattcttatatgtct 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55016009 agcacatgaaaatggttttgttgaagtgatgagtaattgcagactcaccatttgtagcattcttatatgtct 55016080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University