View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11458_low_7 (Length: 303)
Name: NF11458_low_7
Description: NF11458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11458_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 19 - 290
Target Start/End: Original strand, 55015809 - 55016080
Alignment:
| Q |
19 |
gcaagcaggcctaaagactctcccattcgtctcatcttcagcatgggaaagtgtgccatcaactctgccgaatacggcccactctggcgctccctccgcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55015809 |
gcaagcaggcctaaagactctcccattcgtctcatcttcagcatgggaaagtgtgccatcaactctgctgaatacggcccactctggcgctccctccgcc |
55015908 |
T |
 |
| Q |
119 |
gcaaccttgtgacggagatgatatcaccacttagagtaaaacagtgcagttggatcagaaaatgggccatggaagctcacatgagaaggatccaaaatga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55015909 |
gcaaccttgtgacggagatgatatcaccacttagagtaaaacagtgcagttggatcagaaaatgggccatggaagctcacatgagaaggatccaaaatga |
55016008 |
T |
 |
| Q |
219 |
agcacatgaaaatggttttgttgaagtgatgagtaattgcagactcaccatttgtagcattcttatatgtct |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55016009 |
agcacatgaaaatggttttgttgaagtgatgagtaattgcagactcaccatttgtagcattcttatatgtct |
55016080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University