View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_high_103 (Length: 230)
Name: NF1145_high_103
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_high_103 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 96 - 230
Target Start/End: Complemental strand, 25927818 - 25927686
Alignment:
| Q |
96 |
gaccaccacacaataagcaacctcttaattgaaatgagaatattaacatttcattgatgctaagattttatgctctctcaacttgttgtactctttaccg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25927818 |
gaccaccacacaataagcaacctcttaatcgaaatga--atattcacatttcattgatgctaagattttatgctctgtcaacttgttgtactctttacat |
25927721 |
T |
|
| Q |
196 |
gaccttctctttcacatattatttttagccatttt |
230 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
25927720 |
gaccttctctttcacatattattttttgccatttt |
25927686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 20 - 64
Target Start/End: Complemental strand, 25927866 - 25927822
Alignment:
| Q |
20 |
ttgtgcatatttatgaccttagaagaattgagtcagctcatgatt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25927866 |
ttgtgcatatttatgaccttagaagaattgagtcagctcatgatt |
25927822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University