View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_high_105 (Length: 230)
Name: NF1145_high_105
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_high_105 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 7547407 - 7547280
Alignment:
| Q |
1 |
tagcacgtaaactgtgacggaaatgtctacaaagcggataaacctgctctaagattgtgccaatgttcctctttgaaaattctgtgtaagacgacaatag |
100 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |||| |||||||||||| |
|
|
| T |
7547407 |
tagcacgtaaattatgacggaaatgtctacaaagcggctaaacctgctctaagattgtgccaatgttcgtctttgaaaattcagtgttagacgacaatag |
7547308 |
T |
 |
| Q |
101 |
gctgtataataagcttggagaatcaact |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7547307 |
gctgtataataagcttggagaatcaact |
7547280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 1128608 - 1128518
Alignment:
| Q |
19 |
ggaaatgtctacaaagcggataaacctgctctaagattgtgccaatgttcctctttgaaaattctgtgtaagacgacaataggctgtataa |
109 |
Q |
| |
|
|||||||||||| |||| | | |||||||||||||||||||||||||||||||||||| |||||| | |||| ||||||| |||||||| |
|
|
| T |
1128608 |
ggaaatgtctacgaagcagctgaacctgctctaagattgtgccaatgttcctctttgacaattctttagaagataacaatagactgtataa |
1128518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University