View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_high_40 (Length: 371)
Name: NF1145_high_40
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_high_40 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 97 - 371
Target Start/End: Original strand, 2548661 - 2548937
Alignment:
| Q |
97 |
gtgcgcacaacactattttttgatcttgcgaccatattagaatacctttgctcacctatcggctatctaattagattgtattttaannnnnnnnn-ctat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
2548661 |
gtgcgcacaacactattttttgatcttgcggccatattagaatacttttgctcacctaccggctatctaattagattgtattttaattttttttttctat |
2548760 |
T |
 |
| Q |
196 |
tttataagcagaacgaatcaggtgttggaaaatggaaatattctcgccattatatctttc-gattgattttcaaattttattcttatacgagtatcacct |
294 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2548761 |
tctataagcagaacgaatcaggtgttggaaaatggaaatattctcgccattatatccttccgattgatattcaaattttattcttatacgagtatcacct |
2548860 |
T |
 |
| Q |
295 |
aatattgtactagtctacgactgttgcatacttgcacgtaagaactgcaagtaatgttggtggtggttatgtatagt |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2548861 |
aatattgtactagtctacgactgttgcatacttgcatgtaagaattgcaagtaatgttggtggtggttatgtatagt |
2548937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University