View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1145_high_42 (Length: 370)

Name: NF1145_high_42
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1145_high_42
NF1145_high_42
[»] chr3 (2 HSPs)
chr3 (201-286)||(11437013-11437098)
chr3 (123-183)||(11437198-11437258)


Alignment Details
Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 201 - 286
Target Start/End: Complemental strand, 11437098 - 11437013
Alignment:
201 tgatgtttttggaggcaaactagattatgcaataggagatgctttatgctacattaagtttaaactattactttttccaccctatg 286  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
11437098 tgatgtttttggaggcaaactagattatgcaataggagatgctttatgctacattaagtttagactattactttttccaccctatg 11437013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 183
Target Start/End: Complemental strand, 11437258 - 11437198
Alignment:
123 cttcactttatgttggtaggtattttgattcgtcatttggcatgctagaaagaccactgaa 183  Q
    |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||    
11437258 cttcactttatgttggtaggtattttgattagtcatttggcatggtagaaagaccactgaa 11437198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University