View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_high_44 (Length: 370)
Name: NF1145_high_44
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_high_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 201 - 286
Target Start/End: Complemental strand, 11437098 - 11437013
Alignment:
| Q |
201 |
tgatgtttttggaggcaaactagattatgcaataggagatgctttatgctacattaagtttaaactattactttttccaccctatg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11437098 |
tgatgtttttggaggcaaactagattatgcaataggagatgctttatgctacattaagtttagactattactttttccaccctatg |
11437013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 183
Target Start/End: Complemental strand, 11437258 - 11437198
Alignment:
| Q |
123 |
cttcactttatgttggtaggtattttgattcgtcatttggcatgctagaaagaccactgaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
11437258 |
cttcactttatgttggtaggtattttgattagtcatttggcatggtagaaagaccactgaa |
11437198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University