View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_high_75 (Length: 284)
Name: NF1145_high_75
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_high_75 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 6 - 236
Target Start/End: Original strand, 3007806 - 3008036
Alignment:
| Q |
6 |
aaatctaaagtaccaaatgtattttgaatagggggctgtagctgcactacatatggtacattgctttcatttggctggcttccccaaaggtcttattagc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3007806 |
aaatctaaagtaccaaatgtattttgaatagggggctgtagctgcactacatatggtacattgctttcatttggctggcttccccaaaggtcttattagc |
3007905 |
T |
|
| Q |
106 |
tgtgtgacaggaaaaggttctgagatcggcgactttcttacaatgcatccaggggtgaactgcataaggtaatatccacttcttcagctatcttgttagc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3007906 |
tgtgtgacaggaaaaggttctgagatcggcgactttcttacaatgcatccaggggtgaactgcataaggtaatatccacttcttcagctatcttgttaac |
3008005 |
T |
|
| Q |
206 |
attactgtccaattttgtgtttggttttatt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3008006 |
attactgtccaattttgtgtttggttttatt |
3008036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 65 - 175
Target Start/End: Complemental strand, 54726399 - 54726289
Alignment:
| Q |
65 |
attgctttcatttggctggcttccccaaaggtcttattagctgtgtgacaggaaaaggttctgagatcggcgactttcttacaatgcatccaggggtgaa |
164 |
Q |
| |
|
|||||||||| |||||||| || ||||||||||| || |||||||| || || ||||| || || || || ||||| ||||||||||||||||| ||||| |
|
|
| T |
54726399 |
attgctttcacttggctggttttcccaaaggtctaatcagctgtgttactggcaaaggctcagaaattggtgacttccttacaatgcatccaggagtgaa |
54726300 |
T |
|
| Q |
165 |
ctgcataaggt |
175 |
Q |
| |
|
||| ||||||| |
|
|
| T |
54726299 |
ctgtataaggt |
54726289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University