View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_high_80 (Length: 272)
Name: NF1145_high_80
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_high_80 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 51 - 238
Target Start/End: Complemental strand, 41562064 - 41561877
Alignment:
| Q |
51 |
tgagattgaatcgaaccgaagaagaagaacaacaagatgtgattgttccttcggtaattaaatcgtaatcaaaccctaaacgacgagcttgtgaacggtt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41562064 |
tgagattgaatcgaaccgaagaagaagaacaacaagatgtgattgttccttcggtaattaaatcgtaatcaaaccctaaacgacgagcttgtgaacggtt |
41561965 |
T |
 |
| Q |
151 |
gttctgattcggagtgaaccttcctgatcggcagcaatggagccttcaaaggagaatcgcgaacatcttcatcatcttcgtcatcttc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41561964 |
gttctgattcggagtgaaccttcctgatcggcagcgatggagacttcaaaggagaatcgcgaacatcttcatcatcttcgtcatcttc |
41561877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University