View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_high_93 (Length: 251)
Name: NF1145_high_93
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_high_93 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 53659976 - 53659755
Alignment:
| Q |
30 |
ctttgcaattgttctctgggagctgcttacaagaaaggtaatgcttcttgcaatttttcttttcttttcgctcattggatttcttttgcttgtatctata |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53659976 |
ctttgcaattgttctctgggagctgcttacaagaaaggtaatgcttcttgcaatttttcttttcttttcgctcattggatttcttttgcttgtatccata |
53659877 |
T |
|
| Q |
130 |
gagccctagagttaaatcttcaccattaaacgtgacttatcctctctactatgtaaaattctggtaacaatgtatactacatttaacagcagaatttgac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53659876 |
gagccctagagttaaatcttcaccattaaacgtgacttatcctctctactatgtaaaattctggtaacaatgtatactacatttaacagcagaatttgac |
53659777 |
T |
|
| Q |
230 |
aataaaagaggaaaaatgtttc |
251 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
53659776 |
aataaaagaggaagaatgtttc |
53659755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University