View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_109 (Length: 312)
Name: NF1145_low_109
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_109 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 41769967 - 41770270
Alignment:
| Q |
1 |
tttgtttagtttttattttggttgataaggtggtccttcttcctttactttcattcatggggaaggtcacaacttcttcaacaccgcctttttctcaaga |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41769967 |
tttgtttattttttattttggttgataaggtggtccttcttcctttactttcattcatggggaaggtcacaacttcttcaacaccgcctttttctcaaga |
41770066 |
T |
|
| Q |
101 |
agcttccaattttgatgaggtttatatgcagcagagcttgctctttgatgatagcctcaaggtacatatgttttgctactttttcggctattttgaatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41770067 |
agcttccaattttgatgaggtttatatgcagcagagcttgctctttgatgatagcctcaaggtacatatgttttgctactttttcggctattttgaatct |
41770166 |
T |
|
| Q |
201 |
cgatttaactgttatgatcattgcctaatgcatctgttgcttagttcagagtagaatagagcttagttttttgctaattacttttgaatttaacttttca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41770167 |
cgatttaactgttatgatcattgcctaatgcatctgttgcttagttcagagtagaatagagcttagttttttgctaattatttttgaatttaacttttca |
41770266 |
T |
|
| Q |
301 |
tctc |
304 |
Q |
| |
|
|||| |
|
|
| T |
41770267 |
tctc |
41770270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 608935 - 608883
Alignment:
| Q |
102 |
gcttccaattttgatgaggtttatatgcagcagagcttgctctttgatgatag |
154 |
Q |
| |
|
|||||||||| ||||||||||| ||||| || | |||||||||||||||||| |
|
|
| T |
608935 |
gcttccaattatgatgaggttttcatgcatcaaaccttgctctttgatgatag |
608883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University