View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_110 (Length: 312)
Name: NF1145_low_110
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_110 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 21 - 239
Target Start/End: Original strand, 36228181 - 36228399
Alignment:
| Q |
21 |
gagatgaacgttataacgaatccccaaattttgggacctcgaatttacaaaataacatcggtcaataaactgttatcttcgtcttttaggggtgttcggt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||||||||| |
|
|
| T |
36228181 |
gagatgaacgttataacgaatccccaaattttgggacctcgaatttacaaaataacatcggtcaataaaatgttatctccgtcgtttaggggtgttcggt |
36228280 |
T |
 |
| Q |
121 |
gttgaggtgtcacactaaatgacatgttcaccttggtgtggagcattttgacaacttaattataaatcatttaagtctttcaattataatgcataaatcg |
220 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36228281 |
gttaaggtgtcacactaaatgacatgttcaccttggtgtggagcattttgacaacttaattataaatcatttaagtctttcaattataatgcataaatcg |
36228380 |
T |
 |
| Q |
221 |
tcaaaatactccatataac |
239 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36228381 |
tcaaaatactccatataac |
36228399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 237 - 283
Target Start/End: Original strand, 36229705 - 36229751
Alignment:
| Q |
237 |
aacatgttttcaacaagttcatctttgctccattatgaactcgtctt |
283 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36229705 |
aacatgtcttcaacgagttcatctttgctccattatgaactcgtctt |
36229751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University