View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_113 (Length: 309)
Name: NF1145_low_113
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_113 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 74 - 249
Target Start/End: Original strand, 33903494 - 33903669
Alignment:
| Q |
74 |
cacatgaaaggaggagtagaaacaaggtgttgcaagagaagttggtgaggtatttgatgagtcaagaggaatggaagaggtcaggtggaagggatcattt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33903494 |
cacatgaaaggaggagtagaaacaaggtgttgcaagagaagttggtgaggtatttgatgaatcaagaggaatggaagaggtcaggtggaagggatcattt |
33903593 |
T |
|
| Q |
174 |
gatcttggctcatcatcctaatagtatgttggatgctagaatgaaactttggcctgcaacttttatattgtctgat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33903594 |
gatcttggctcatcatcctaatagtatgttggatgctagaatgaaactttggcctgcaacttttatattgtctgat |
33903669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 106 - 240
Target Start/End: Complemental strand, 9327639 - 9327505
Alignment:
| Q |
106 |
caagagaagttggtgaggtatttgatgagtcaagaggaatggaagaggtcaggtggaagggatcatttgatcttggctcatcatcctaatagtatgttgg |
205 |
Q |
| |
|
|||||| ||||||||| |||| ||| ||||||||||||||| |||||| |||| |||||| |||| | || |||||||||||||||||||||| |
|
|
| T |
9327639 |
caagaggagttggtgaagtatgtgacatctcaagaggaatggaaaaggtcaaagggaaaagatcatgtgattatagcacatcatcctaatagtatgttgg |
9327540 |
T |
|
| Q |
206 |
atgctagaatgaaactttggcctgcaacttttata |
240 |
Q |
| |
|
|||| ||||||||| | ||||| || || |||||| |
|
|
| T |
9327539 |
atgcaagaatgaaattgtggccagctacatttata |
9327505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University