View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1145_low_120 (Length: 298)

Name: NF1145_low_120
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1145_low_120
NF1145_low_120
[»] chr4 (1 HSPs)
chr4 (1-112)||(22415271-22415382)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 22415382 - 22415271
Alignment:
1 aaaatttcaaaaaatgatgtacatgacaaaatcaattaggcaagatagatatgatgagattttgattttactatagacgcctttttaacctatgaatgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22415382 aaaatttcaaaaaatgatgtacatgacaaaatcaattaggcaagatagatatgatgagattttgattttactatagacgcctttttaacctatgaatgat 22415283  T
101 gagatatgatga 112  Q
    ||||||||||||    
22415282 gagatatgatga 22415271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University