View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_120 (Length: 298)
Name: NF1145_low_120
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_120 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 22415382 - 22415271
Alignment:
| Q |
1 |
aaaatttcaaaaaatgatgtacatgacaaaatcaattaggcaagatagatatgatgagattttgattttactatagacgcctttttaacctatgaatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22415382 |
aaaatttcaaaaaatgatgtacatgacaaaatcaattaggcaagatagatatgatgagattttgattttactatagacgcctttttaacctatgaatgat |
22415283 |
T |
 |
| Q |
101 |
gagatatgatga |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22415282 |
gagatatgatga |
22415271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University