View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_123 (Length: 294)
Name: NF1145_low_123
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_123 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 46588024 - 46587826
Alignment:
| Q |
1 |
cgtgtagatggaacagcaatgaacttggtgagtccagcaatacagtcataggcattaccttcatcagaggcaaagtaataaggcttcaactgattcagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46588024 |
cgtgtagatggaacagcaatgaacttggtgagtccagcaatacagtcataggcattgccttcatcagaggcaaagtaataaggcttcaattgattcagct |
46587925 |
T |
 |
| Q |
101 |
caatctttatcccctcaccaccaccttgttcagcactaccaagcaactttgctcctctaaattcacacgtcgtgtaactccacatattcggtagcaagt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46587924 |
caatctttatcccctcaccaccaccttgatcagcactaccaagcaactttgctcctctaaattcacacgtcgtgtaactccacatattcggtagcaagt |
46587826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University