View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1145_low_125 (Length: 293)

Name: NF1145_low_125
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1145_low_125
NF1145_low_125
[»] chr3 (1 HSPs)
chr3 (66-244)||(403704-403882)


Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 66 - 244
Target Start/End: Original strand, 403704 - 403882
Alignment:
66 ggattacctcgccggcggcgattcggttaacgactgattccgctaggcgttggattttgggtggcgactccatcttttacggtgtttgttgggttttgga 165  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||    
403704 ggattacctcgccggcggcgattcggttaacgaccgattccgctaggcgttgaattttgggtggcgattccatcttttacggtgtttgttgggttttgga 403803  T
166 gtgacgagaaatggaatttgttcgcgggagtatgaatgttgtactgggcgggagagagagaaggaatccatatcagtat 244  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
403804 gtgacgagaaatggaatttgttcgcgggagtatgaatgttgtactgggcgggagagagagaaggaatccatatcagtat 403882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University