View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_126 (Length: 291)
Name: NF1145_low_126
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_126 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 52 - 159
Target Start/End: Original strand, 53007905 - 53008012
Alignment:
| Q |
52 |
tatagcaacttagtttccatcttcttgagcatataaataactaatggttgaaattggtagaagaaacctgagtcccacccactcctatgcagttgctgaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53007905 |
tatagcaacttagtttccatcttcttgagcatataaataactaatggttgaaattggtagaagaaacctgagtcccacccactcctatgcagttgctgaa |
53008004 |
T |
 |
| Q |
152 |
aaatcatg |
159 |
Q |
| |
|
|||||||| |
|
|
| T |
53008005 |
aaatcatg |
53008012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University