View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_133 (Length: 279)
Name: NF1145_low_133
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_133 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 30 - 271
Target Start/End: Original strand, 28490115 - 28490356
Alignment:
| Q |
30 |
cagtgaaggtggacttgatttttacaacgtcagcgtggtagacggtttcaacgtccctattctggtggttcctattggtggttctggcaagaattgtagc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
28490115 |
cagtgaaggtggacttgatttttacaacgtcagcgtggtagacggtttcaacgtccccattctggtggttcctgttggtggttctggcgagaattgtagc |
28490214 |
T |
 |
| Q |
130 |
agcactggttgtcctgtggatcttaataacgagtgtcccacaaatcttcgggtctacaacaaaagtaaagtggtggggtgccaaggtgcttgttctgcat |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28490215 |
agcaccggttgtcctgtggatcttaataacgagtgtcccacaaatcttcgggtctacaacaaaagtaaagtggtggggtgccaaggtgcttgttctgcat |
28490314 |
T |
 |
| Q |
230 |
taaaattgaagcatttttgctgcgttggaaaatattcatctc |
271 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
28490315 |
taaaattgaagcaattttgctgtgttggaaaatattcatctc |
28490356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University