View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1145_low_145 (Length: 261)

Name: NF1145_low_145
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1145_low_145
NF1145_low_145
[»] chr6 (3 HSPs)
chr6 (16-232)||(31787300-31787516)
chr6 (89-145)||(31787264-31787320)
chr6 (97-145)||(31787120-31787168)


Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 31787516 - 31787300
Alignment:
16 gacaggaaccggaacaaccggctatggagctaccggtggcggaactggagtaggatatggcggaactggacatgataatagaggggtaatggacaagatt 115  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31787516 gacaggaactggaacaaccggctatggagctaccggtggcggaactggagtaggatatggcggaactggacatgataatagaggggtaatggacaagatt 31787417  T
116 aaggagaaaattcctggtactgatcaaaatgctagtacttatgggacaggaacaggatatggaacaactggtattggtcatcaacaacatggaggagata 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31787416 aaggagaaaattcctggtactgatcaaaatgctagtacttatgggacaggaacaggatatggaacaactggtattggtcatcaacaacatggaggagata 31787317  T
216 atagaggggttatggac 232  Q
    | |||||||||||||||    
31787316 acagaggggttatggac 31787300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 89 - 145
Target Start/End: Complemental strand, 31787320 - 31787264
Alignment:
89 gataatagaggggtaatggacaagattaaggagaaaattcctggtactgatcaaaat 145  Q
    ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||    
31787320 gataacagaggggttatggacaagattaaggagaaaattcctggtactgatcaaaat 31787264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 97 - 145
Target Start/End: Complemental strand, 31787168 - 31787120
Alignment:
97 aggggtaatggacaagattaaggagaaaattcctggtactgatcaaaat 145  Q
    |||||| |||||||||||||||||||| |||||||||||||| ||||||    
31787168 aggggttatggacaagattaaggagaagattcctggtactgaacaaaat 31787120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University