View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_152 (Length: 252)
Name: NF1145_low_152
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_152 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 84 - 148
Target Start/End: Original strand, 25944900 - 25944964
Alignment:
| Q |
84 |
ggtatatcaattgtttgttacactaaaaagataatgagtttaaaaaattaagattttatccgtgg |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25944900 |
ggtatatcaattgtttgttacactaaaaagataatgagtttaaaaaattaagattttatccgtgg |
25944964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 201 - 252
Target Start/End: Original strand, 25945017 - 25945068
Alignment:
| Q |
201 |
cactacgcaaccctacttaagcttgagctaccgtcgctcttcacggtgcgtt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25945017 |
cactacgcaaccctacttaagcttgagctaccgtcgctcttcacggtgcgtt |
25945068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 92 - 141
Target Start/End: Original strand, 25950762 - 25950811
Alignment:
| Q |
92 |
aattgtttgttacactaaaaagataatgagtttaaaaaattaagatttta |
141 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25950762 |
aattgtttgttatactaaaaagataatgagtttaaaaaattaagaattta |
25950811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 12 - 71
Target Start/End: Original strand, 25944827 - 25944882
Alignment:
| Q |
12 |
agagatagagtgcgagcaaaaaacaaaagagtttgtcagaagaagagagtatatcaattg |
71 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
25944827 |
agagatagagtgcgaggaaaa-acaaaagagtttgt---tagaagagagtatatcaattg |
25944882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University