View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_153 (Length: 252)
Name: NF1145_low_153
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_153 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 6405448 - 6405207
Alignment:
| Q |
1 |
ttaatcactaaattaatattatatctcctagttccacatatatgaaaa-gggcaaacaatgacaaaagagtcttatatttaagggtaaaatgagtaatta |
99 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6405448 |
ttaatcactaagttaatattatatctcatagttccacatatatgaaaaagggcagacaatgacaaaagagtcttatatttaaaggtaaaatgagtaatta |
6405349 |
T |
 |
| Q |
100 |
atattacaacaaaatttagaagtgacatccaggtcaaaattttatttttccaaatgtgtaacctcttctagaaagaagtggataaagaatcgctcgtaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6405348 |
atattacaacaaaatttagaagtgacatccagttcaaaattttatttttgcaaatgtgtaaccttttctagaaagaagtggataaagaatcgctcgtaga |
6405249 |
T |
 |
| Q |
200 |
ttaacggtnnnnnnnnttagactattactttttccaccctatgc |
243 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
6405248 |
ttaacggt--aaaaaattagactattattttttccaccctatgc |
6405207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University