View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_160 (Length: 251)
Name: NF1145_low_160
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_160 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 52380206 - 52380386
Alignment:
| Q |
1 |
aaattcttaagaattttacagccttgtggcggtggggattagataccaattcccactgttatagtcattatattcggtaacaacataaggcaaagaaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52380206 |
aaattcttaagaattttacagccttgtggcggtggggattagataccaattcccactgttatagtcattatattcggtaacaacatgaggcaaagaaaga |
52380305 |
T |
 |
| Q |
101 |
tattatgcgtcctttcattcaagctagatagcgagataactctagaatcattatctcgtcacttatttttgcaacttgagg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380306 |
tattatgcgtcctttcattcaagctagatagcgagataactctagaatcattatctcgtcacttatttttgcaacttgagg |
52380386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 240
Target Start/End: Original strand, 52380400 - 52380438
Alignment:
| Q |
202 |
ctacttactcttttttctcgatcacatcattatattcat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380400 |
ctacttactcttttttctcgatcacatcattatattcat |
52380438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University