View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_165 (Length: 248)
Name: NF1145_low_165
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_165 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 43238253 - 43238124
Alignment:
| Q |
1 |
ctcttgcattgatttatttttatataaattttgagtatataattttgctcccataaattaaaatgtatggatccgtccatgctataaatgcatcctggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43238253 |
ctcttgcattgatttatttttatataaattttgagtatataattttgctcccataaattaaaatgtatggatccgtccctgctataaatgcatcctggtt |
43238154 |
T |
|
| Q |
101 |
cccctctttcttcttccatttgtttcagca |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43238153 |
cccctctttcttcttccatttgtttcagca |
43238124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 27428492 - 27428408
Alignment:
| Q |
1 |
ctcttgcattgatttatttttatataaattttgagtatataattttgctcccataaattaaaatgtatggatccgtccatgctat |
85 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||| ||| |||| ||||| | | ||||||||| |||||| |
|
|
| T |
27428492 |
ctcttgcattgatttatttttatataaatgttgagtataaaattttgtccccgcaaatcaaaatttctagatccgtccctgctat |
27428408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 7339331 - 7339268
Alignment:
| Q |
1 |
ctcttgcattgatttatttttatataaattttgagtatataattttgctcccataaattaaaat |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||| |
|
|
| T |
7339331 |
ctcttgcattgatttatttttatataaattttgagtatataattttgcccccacaaatcaaaat |
7339268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University