View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_167 (Length: 246)
Name: NF1145_low_167
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_167 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 46587897 - 46588107
Alignment:
| Q |
12 |
caaggtgatgatgaggggataaagattgagctgaatcagttgaagccttattactttgcctctgatgaaggtaatgcctatgactgtattgctggactca |
111 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46587897 |
caaggtggtggtgaggggataaagattgagctgaatcaattgaagccttattactttgcctctgatgaaggcaatgcctatgactgtattgctggactca |
46587996 |
T |
|
| Q |
112 |
ccaagttcattgctgttccatctacacgttccttttaatttagccctcatggcccaattgaatcaagttgtttccttttaaggtagttgaattcaatata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
46587997 |
ccaagttcattgctgttccatctacacgttccttttaatttaaccctcatggcccaattgaatcaagttatttccttttaaggtagttgaattcaaaata |
46588096 |
T |
|
| Q |
212 |
taaataaaatg |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
46588097 |
taaataaaatg |
46588107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University