View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_168 (Length: 243)
Name: NF1145_low_168
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_168 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 43238248 - 43238124
Alignment:
| Q |
1 |
gcattgatttatttttatataaattttgagtatataattttgctcccataaattaaaatgtatggatccgtccatgctataaatgcatcctggttcccct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43238248 |
gcattgatttatttttatataaattttgagtatataattttgctcccataaattaaaatgtatggatccgtccctgctataaatgcatcctggttcccct |
43238149 |
T |
|
| Q |
101 |
ctttcttcttccatttgtttcagca |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43238148 |
ctttcttcttccatttgtttcagca |
43238124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 27428487 - 27428408
Alignment:
| Q |
1 |
gcattgatttatttttatataaattttgagtatataattttgctcccataaattaaaatgtatggatccgtccatgctat |
80 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||| ||| |||| ||||| | | ||||||||| |||||| |
|
|
| T |
27428487 |
gcattgatttatttttatataaatgttgagtataaaattttgtccccgcaaatcaaaatttctagatccgtccctgctat |
27428408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 7339326 - 7339268
Alignment:
| Q |
1 |
gcattgatttatttttatataaattttgagtatataattttgctcccataaattaaaat |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||| |
|
|
| T |
7339326 |
gcattgatttatttttatataaattttgagtatataattttgcccccacaaatcaaaat |
7339268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University