View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_173 (Length: 230)
Name: NF1145_low_173
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_173 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 3658798 - 3658569
Alignment:
| Q |
1 |
atgcaaagaagactctaaatcttgcatacaagcagacagcaagcaactattggtgatgtatttagcactttatgtcacagccctcggcactggcggtcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3658798 |
atgcaaagaagactctaaatcttgcatacaagcagacagcaagcaactattggtgatgtatttagcactttatatcacagccctcggcactggcggtcta |
3658699 |
T |
|
| Q |
101 |
aaatctagtgtctctggccttggttccgatcaatttgatgattcagatgaccaagaaaagaagggtatgattaaatttttcagctggttccattttttcg |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3658698 |
aaatctagtgtctctggctttggttccgatcaatttgatgattcagatgaccaagaaaagaagggtatgattaaatttttcagctggttctattttttcg |
3658599 |
T |
|
| Q |
201 |
taagcataggggctttggcagcagtgactg |
230 |
Q |
| |
|
||||||||||| |||||||||||||||||| |
|
|
| T |
3658598 |
taagcatagggtctttggcagcagtgactg |
3658569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 61 - 140
Target Start/End: Complemental strand, 3646305 - 3646226
Alignment:
| Q |
61 |
tttagcactttatgtcacagccctcggcactggcggtctaaaatctagtgtctctggccttggttccgatcaatttgatg |
140 |
Q |
| |
|
|||||| ||||||||||| || || ||||| || ||| ||||||| |||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
3646305 |
tttagcgctttatgtcactgcacttggcacagggggtttaaaatccagtgtccctggctttggttcagatcaatttgatg |
3646226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University