View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_177 (Length: 227)
Name: NF1145_low_177
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_177 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 46588000 - 46588217
Alignment:
| Q |
1 |
agttcattgctgttccatctacacgttccttttaatttagccctcatggcccaattgaatcaagttttttccttttaaggtagttgaattcaatatataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
46588000 |
agttcattgctgttccatctacacgttccttttaatttaaccctcatggcccaattgaatcaagttatttccttttaaggtagttgaattcaaaatataa |
46588099 |
T |
 |
| Q |
101 |
ataaaatggatggtttcaatctgttttttctttcctgaagtatcgaaagnnnnnnnnttatgttttttattgtggtttgtg-tacctagaaagaaatgat |
199 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |||||||| | | | ||| |
|
|
| T |
46588100 |
ataaaatggatggtttccatctgttttttctttcctggagtatcgaaagaaaaaaaattatgttttttattgtggtttgtgctacctagataaatacgat |
46588199 |
T |
 |
| Q |
200 |
gatgtatttttgtctctg |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46588200 |
gatgtatttttgtctctg |
46588217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University