View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1145_low_181 (Length: 221)

Name: NF1145_low_181
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1145_low_181
NF1145_low_181
[»] chr4 (1 HSPs)
chr4 (1-117)||(37896099-37896216)
[»] chr7 (1 HSPs)
chr7 (60-117)||(42446836-42446893)
[»] chr6 (1 HSPs)
chr6 (59-117)||(29140910-29140968)


Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 37896216 - 37896099
Alignment:
1 aatttagatttggaatgcaaaagaaaaatgaagcataaaatttaacaatagtggcatggatattgctggcaaaatgcaa-tgaaagttcaaatgtagata 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||    
37896216 aatttagatttggaatgcaaaagaaaaatgaagcataaaatttaacaatagtggcatggatattgctcgcaaaatgcaattgaaagttcaaatgtagata 37896117  T
100 tgttgctcatcagattat 117  Q
    ||||||||||||||||||    
37896116 tgttgctcatcagattat 37896099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 60 - 117
Target Start/End: Complemental strand, 42446893 - 42446836
Alignment:
60 atattgctggcaaaatgcaatgaaagttcaaatgtagatatgttgctcatcagattat 117  Q
    |||||||||||| |||| ||||| || |||||| ||||| ||||||||||||||||||    
42446893 atattgctggcagaatgtaatgacagatcaaatatagatctgttgctcatcagattat 42446836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 117
Target Start/End: Complemental strand, 29140968 - 29140910
Alignment:
59 gatattgctggcaaaatgcaatgaaagttcaaatgtagatatgttgctcatcagattat 117  Q
    ||||||||||| | |||| |||||||||||||||  |||| |||||||||| |||||||    
29140968 gatattgctggtacaatgtaatgaaagttcaaatagagatttgttgctcattagattat 29140910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University