View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1145_low_183 (Length: 221)

Name: NF1145_low_183
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1145_low_183
NF1145_low_183
[»] chr7 (1 HSPs)
chr7 (131-197)||(31201578-31201644)


Alignment Details
Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 131 - 197
Target Start/End: Complemental strand, 31201644 - 31201578
Alignment:
131 aatatcttcgggataaacaagagaatggccagcaagtgaaagtgagattatatcaacaccatcacta 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31201644 aatatcttcgggataaacaagagaatggccagcaagtgaaagtgagattatatcaacaccatcacta 31201578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University