View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_188 (Length: 216)
Name: NF1145_low_188
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_188 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 61 - 195
Target Start/End: Original strand, 21085063 - 21085197
Alignment:
| Q |
61 |
agtagcaaagggcaaagaagaagataagaagactgaaaatgcagtgtcagcttctgaaaaaccagcagcagcatcaaatggtgttgtaaaggatccttta |
160 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21085063 |
agtagcaaaaggcaaagaagaagataagaagacagaaaatgcagtgtcagcttctgaaaaagcagcagcagcatcaaatggtgttgtaaaggatccttta |
21085162 |
T |
 |
| Q |
161 |
ggtgatgcaaggaacaaggttcaagatgagataat |
195 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21085163 |
ggtgatgcaaggagcaaggttcaagatgagataat |
21085197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University