View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_190 (Length: 215)
Name: NF1145_low_190
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_190 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 37896216 - 37896099
Alignment:
| Q |
1 |
aatttagatttggaatgcaaaagaaaaatgaagcataaaatttaacaatagtggcatggatattgctggcaaaatgcaa-tgaaagttcaaatgtagata |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
37896216 |
aatttagatttggaatgcaaaagaaaaatgaagcataaaatttaacaatagtggcatggatattgctcgcaaaatgcaattgaaagttcaaatgtagata |
37896117 |
T |
 |
| Q |
100 |
tgttgctcatcagattat |
117 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37896116 |
tgttgctcatcagattat |
37896099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 60 - 117
Target Start/End: Complemental strand, 42446893 - 42446836
Alignment:
| Q |
60 |
atattgctggcaaaatgcaatgaaagttcaaatgtagatatgttgctcatcagattat |
117 |
Q |
| |
|
|||||||||||| |||| ||||| || |||||| ||||| |||||||||||||||||| |
|
|
| T |
42446893 |
atattgctggcagaatgtaatgacagatcaaatatagatctgttgctcatcagattat |
42446836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 117
Target Start/End: Complemental strand, 29140968 - 29140910
Alignment:
| Q |
59 |
gatattgctggcaaaatgcaatgaaagttcaaatgtagatatgttgctcatcagattat |
117 |
Q |
| |
|
||||||||||| | |||| ||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
29140968 |
gatattgctggtacaatgtaatgaaagttcaaatagagatttgttgctcattagattat |
29140910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University