View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_191 (Length: 211)
Name: NF1145_low_191
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_191 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 8840429 - 8840553
Alignment:
| Q |
1 |
tgggggagatgttgatcggaggatatgaaagtgagtgttgtcaggtgtacattgtggcgagaaggaccgcgttcgaggagattcaacagcagctggggct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8840429 |
tgggggagatgttgatcggaggatatgaaagtgagtgttgtcaggtgtacattgtggcgagaaggaccgcgttcgaggagattcaacagcagctggggct |
8840528 |
T |
|
| Q |
101 |
ggaaagaatcagtattgatgatatt |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8840529 |
ggaaagaatcagtattgatgatatt |
8840553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University