View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_195 (Length: 202)
Name: NF1145_low_195
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_195 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 39249991 - 39250104
Alignment:
| Q |
1 |
atataacctttcttgtattggttgggtcaatagattataatagggttggaggggtcaatttctttttcttctcttgaaaaattgtatgaagaatagttta |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39249991 |
atataacctttcttgtattggctgggtcaatagattataatagggttggaggggtcaatttctttttcttctcttgaaaaattgtataaagaatagttta |
39250090 |
T |
|
| Q |
101 |
actttatttagatt |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39250091 |
actttatttagatt |
39250104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University